Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250565

Morpholino Name: ugdh MO1
Synonyms: xUGDH MO
Target mRNA: ugdh

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGTTTATCTTGCTGAGAACAGA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:89734383..89734407 21/25 Antisense off-target tor2a.L
Chr7L:76908363..76908387 21/25 Sense off-target pknox2.L
Chr3S:1399847..1399871 21/25 Antisense off-target ppfibp1.S
Chr9_10L:131175413..131175437 21/25 Antisense off-target rnf112l.L
Chr4S:67144740..67144764 21/25 Sense off-target LOC108714984
Chr2L:115810808..115810832 21/25 Antisense unknown
Chr3L:46334222..46334246 21/25 Antisense unknown
Chr9_10L:72777494..72777518 21/25 Sense unknown
tropicalis 10.0 Chr2:111352893..111352917 21/25 Antisense unknown
Chr5:96420910..96420934 21/25 Antisense unknown
Publications
First: Molecular cloning and characterization of UDP-glucose dehydrogenase from the amphibian Xenopus laevis and its involvement in hyaluronan synthesis., J Biol Chem 2006  
Most recent:
View All Papers