Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250495

Morpholino Name: tgfbi MO1
Synonyms: Xtgfbi MO1
Target mRNA: tgfbi

Morpholino Type: uncategorized morpholino
Sequence: 5' GAAACTGAAAAACACCAGTGAATTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 25/25
genome
MO
5' GAATTCGTTGGTGTTTTTCAGTTTT 3'
   ||||||  |||||||||||||||| 
3' CTTAAGTGACCACAAAAAGTCAAAG 5'
5' GAATTCACTGGTGTTTTTCAGTTTC 3'
   |||||||||||||||||||||||||
3' CTTAAGTGACCACAAAAAGTCAAAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:43207047..43207071 25/25 Antisense target tgfbi.L
Chr3S:111204973..111204997 24/25 Sense off-target LOC108712407
Chr5L:133546222..133546246 22/25 Sense off-target epha4.L
Chr9_10S:105830386..105830410 22/25 Sense off-target LOC108703232
Chr8S:11277385..11277409 21/25 Antisense off-target LOC108699771
Chr1L:143439685..143439709 21/25 Antisense unknown
Chr9_10S:1570256..1570280 21/25 Sense unknown
tropicalis 10.0 Chr3:35813606..35813630 22/25 Antisense target tgfbi
Chr5:108732810..108732834 22/25 Sense off-target usp13
Publications
First: The Xenopus Tgfbi is required for embryogenesis through regulation of canonical Wnt signalling., Dev Biol 2013                              
Most recent:
View All Papers