Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250438

Morpholino Name: szl MO1
Synonyms: MOSZL, Sizzled MO, Szl MO, szlMO
Target mRNA: szl

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGGAGCAGGAAGACTCCGGTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genome
MO
5' CATGACTGGAGTCTTCCTGCTCCTC 3'
   |||||| ||||||||||||||||||
3' GTACTGGCCTCAGAAGGACGAGGAG 5'
5' CATGACTGGAGTCTTCCTGCTCCTC 3'
   |||||| ||||||||||||||||||
3' GTACTGGCCTCAGAAGGACGAGGAG 5'
5' CATGTCCGGAGTCTTCCTGCTCCTC 3'
   |||| ||||||||||||||||||||
3' GTACTGGCCTCAGAAGGACGAGGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:78197199..78197223 24/25 Antisense target szl.L
Chr3S:77122763..77122787 24/25 Sense target szl.S
Chr9_10L:10003115..10003139 22/25 Antisense off-target prex1.L
Chr9_10S:8968287..8968311 22/25 Antisense off-target prex1.S
Chr6L:127988770..127988794 22/25 Sense off-target LOC108719287
tropicalis 10.0 Chr3:71700011..71700035 24/25 Antisense target szl
Publications
First: The secreted Frizzled-related protein Sizzled functions as a negative feedback regulator of extreme ventral mesoderm., Development 2003          
Most recent: Syndecan4 coordinates Wnt/JNK and BMP signaling to regulate foregut progenitor development., Dev Biol 2016                                    
View All Papers