Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250430

Morpholino Name: sulf2 MO1
Synonyms: Xt sulf2 S2 AMO, Xtsulf2
Target mRNA: sulf2

Morpholino Type: uncategorized morpholino
Sequence: 5' GAACAATATTCGCTGCTGCCCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GATGGGGCAGCAGCGAATATTGTTC 3'
   |||||||||||||||||||||||||
3' CTACCCCGTCGTCGCTTATAACAAG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:23099377..23099401 21/25 Antisense off-target add1.L
Chr9_10L:15568250..15568274 22/25 Sense unknown
tropicalis 10.0 Chr10:37092338..37092362 25/25 Antisense target sulf2
Publications
First: Neural crest migration requires the activity of the extracellular sulphatases XtSulf1 and XtSulf2., Dev Biol 2010                                
Most recent:
View All Papers