Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250428

Morpholino Name: sulf1 MO2
Synonyms: XtSulf1, XtSulf1 AMO4, Xtsulf1- S1AMO4
Target mRNA: sulf1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTGCAACGAACCTGAAATAAATAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' TTATTTATTTCAGGTTCGTTGCAGG 3'
   |||||||||||||||||||||||||
3' AATAAATAAAGTCCAAGCAACGTCC 5'
5' TTATTTATTTCAGGTTCGTTGCAGG 3'
   |||||||||||||||||||||||||
3' AATAAATAAAGTCCAAGCAACGTCC 5'
5' TTATTTATTTCAGGTTCGTTGCAGG 3'
   |||||||||||||||||||||||||
3' AATAAATAAAGTCCAAGCAACGTCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:128400769..128400793 25/25 Antisense target sulf1.L
Chr6S:105561639..105561663 25/25 Antisense target sulf1.S
Chr1S:185118402..185118426 21/25 Sense unknown
tropicalis 10.0 Chr6:119952362..119952386 25/25 Antisense target sulf1
Publications
First: Extracellular regulation of developmental cell signaling by XtSulf1., Dev Biol 2008              
Most recent: Neural crest migration requires the activity of the extracellular sulphatases XtSulf1 and XtSulf2., Dev Biol 2010                                
View All Papers