Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250415

Morpholino Name: stat3.1 MO1
Synonyms: Stat3, stat3 MO, xSTAT3
Target mRNA: stat3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTCCACTGCGCCATTGTGTGGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' GCACACAAAATGGCGCAGTGGAACC 3'
   || |||| |||||||||||||||||
3' CGGGTGTGTTACCGCGTCACCTTGG 5'
5' GCCCACACAATGGCGCAGTGGAACC 3'
   |||||||||||||||||||||||||
3' CGGGTGTGTTACCGCGTCACCTTGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:448806..448830 25/25 Antisense target stat3.1.L
Chr9_10L:470612..470636 24/25 Antisense off-target stat3.2.L
Chr1S:113863348..113863372 21/25 Antisense off-target nfia.S
Chr9_10S:424855..424879 21/25 Antisense off-target LOC108702458
Chr9_10S:444314..444338 21/25 Antisense off-target LOC108702458
tropicalis 10.0 Chr10:6407738..6407762 23/25 Antisense target stat3.1
Chr10:6448496..6448520 23/25 Antisense off-target stat3.2
Publications
First: Role of the TAK1-NLK-STAT3 pathway in TGF-beta-mediated mesoderm induction., Genes Dev 2004  
Most recent: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
View All Papers