Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250386

Morpholino Name: sox9 MO1
Synonyms: Sox9 MO, Sox9-AS, Sox9-mo, xSox9 MO
Target mRNA: sox9

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAAAAATGGGGAAAGGTAAGAAAG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' CTTTCTTACCTTTCCCCATTTTTGC 3'
   |||||||||||||||||||||||||
3' GAAAGAATGGAAAGGGGTAAAAACG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:19840804..19840828 25/25 Antisense target sox9.S
Chr1S:127983181..127983205 22/25 Antisense off-target sema4d.S
Chr1S:164411012..164411036 21/25 Sense off-target chd1.S
Chr5S:135579425..135579449 21/25 Sense off-target cyp2f1.S
Chr9_10S:14173297..14173321 21/25 Antisense off-target LOC108702627
Chr1S:16712574..16712598 21/25 Antisense off-target LOC121399270
Chr2L:128091835..128091859 21/25 Sense off-target LOC108708487
Chr2S:103549195..103549219 21/25 Antisense off-target LOC108708959
Chr4S:82698328..82698352 22/25 Antisense unknown
Chr5L:72060464..72060488 21/25 Antisense unknown
Chr9_10L:70264092..70264116 21/25 Antisense unknown
Chr9_10L:83026730..83026754 21/25 Antisense unknown
Chr4L:45666207..45666231 21/25 Sense unknown
tropicalis 10.0 Chr5:37495018..37495042 21/25 Sense off-target dtd1
Chr3:104343362..104343386 21/25 Antisense off-target fam227b
Chr7:29683746..29683770 22/25 Antisense unknown
Publications
First: The transcription factor Sox9 is required for cranial neural crest development in Xenopus., Development 2002          
Most recent: PFKFB4 control of AKT signaling is essential for premigratory and migratory neural crest formation., Development 2017                                  
View All Papers