Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250380

Morpholino Name: sox3 MO3
Synonyms: Sox3, xsox3
Target mRNA: sox3

Morpholino Type: uncategorized morpholino
Sequence: 5' AACATGCTATACATTTGGAGCTTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25 24/25
genome
MO
5' TGCAGCTCCAGATGTATAGCATGTT 3'
   || ||||||| ||||||||||||||
3' ACTTCGAGGTTTACATATCGTACAA 5'
5' CGCAGCTCCAGATGTATAGCATGTT 3'
    | ||||||| ||||||||||||||
3' ACTTCGAGGTTTACATATCGTACAA 5'
5' TGCAGCTCCAAATGTATAGCATGTT 3'
   || ||||||||||||||||||||||
3' ACTTCGAGGTTTACATATCGTACAA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:63300575..63300599 24/25 Sense target sox3.S
Chr8L:46992965..46992989 22/25 Sense target sox3.L
Chr8L:46992965..46992989 22/25 Sense off-target LOC121397027
tropicalis 10.0 Chr8:55347987..55348011 23/25 Sense target sox3
Chr9:79707061..79707085 23/25 Sense unknown
Publications
First: The beta-catenin/VegT-regulated early zygotic gene Xnr5 is a direct target of SOX3 regulation., Development 2003    
Most recent: A transition from SoxB1 to SoxE transcription factors is essential for progression from pluripotent blastula cells to neural crest cells., Dev Biol 2018                  
View All Papers