Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250377

Morpholino Name: sox2 MO4
Synonyms: Sox2
Target mRNA: sox2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCCATCATGCTGTACATGCAGGCG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 23/25
genome
MO
5' CGCCTCGATGTACAGCATGATGGAG 3'
   |||||  ||||||||||||||||||
3' GCGGACGTACATGTCGTACTACCTC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:114960543..114960567 23/25 Sense target sox2.L
Chr5S:94686929..94686953 24/25 Sense off-target LOC108718087
Chr4L:129890018..129890042 21/25 Antisense off-target grm7.L
Chr2L:89566351..89566375 21/25 Antisense off-target stk40.L
Chr3S:72187694..72187718 21/25 Antisense off-target magi2.S
Chr2L:169448580..169448604 21/25 Sense off-target LOC108707572
tropicalis 10.0 Chr5:2222007..2222031 21/25 Antisense off-target slc35b2
Publications
First: Eya1 and Six1 promote neurogenesis in the cranial placodes in a SoxB1-dependent fashion., Dev Biol 2008                    
Most recent: A transition from SoxB1 to SoxE transcription factors is essential for progression from pluripotent blastula cells to neural crest cells., Dev Biol 2018                  
View All Papers