Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250314

Morpholino Name: six1 MO2
Synonyms: Six1MO2, six1
Target mRNA: six1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCACACGCAAACACATACACGGG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 24/24
genome
MO
5' CCCGTGTATGTGTTTGCGTGTGCG 3'
   ||||||||||||||||||||||||
3' GGGCACATACACAAACGCACACGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:93774978..93775001 24/24 Antisense target six1.L
Chr8S:102209466..102209489 21/24 Antisense off-target tpm3.S
Chr7L:83730660..83730683 20/24 Antisense off-target sik3.L
Chr4L:108377592..108377615 20/24 Sense off-target nr5a2.L
Chr4L:80152895..80152918 20/24 Sense off-target dock7.L
Chr6L:103522941..103522964 20/24 Antisense off-target sall3.L
Chr6S:84297349..84297372 20/24 Antisense off-target sall3.S
Chr4S:99191747..99191770 20/24 Antisense off-target tnrc6b.S
Chr4L:80152895..80152918 20/24 Sense off-target angptl3.L
Chr2S:106176141..106176164 20/24 Sense off-target LOC108709734
Chr4L:16972463..16972486 20/24 Sense off-target LOC108713833
Chr7L:8496210..8496233 20/24 Sense off-target LOC108696071
Chr7L:8496333..8496356 20/24 Sense off-target LOC108696071
Chr7S:98010300..98010323 20/24 Antisense off-target LOC108697787
Chr8L:43682750..43682773 20/24 Antisense off-target LOC108698409
Chr8L:80302417..80302440 22/24 Sense unknown
Chr8S:18946330..18946353 22/24 Antisense unknown
Chr6S:62553694..62553717 21/24 Sense unknown
Chr1S:190160378..190160401 20/24 Sense unknown
Chr1S:63218427..63218450 20/24 Sense unknown
Chr1S:63218983..63219006 20/24 Sense unknown
Chr4L:1799971..1799994 20/24 Sense unknown
Chr4L:66327106..66327129 20/24 Antisense unknown
Chr4S:80441300..80441323 20/24 Antisense unknown
Chr5S:115812904..115812927 20/24 Antisense unknown
Chr6S:114270546..114270569 20/24 Sense unknown
Chr6S:26905402..26905425 20/24 Antisense unknown
Chr7L:78216116..78216139 20/24 Antisense unknown
Chr8L:105881983..105882006 20/24 Sense unknown
tropicalis 10.0 Chr3:49473477..49473500 20/24 Antisense off-target stab2
Chr4:150729266..150729289 20/24 Antisense off-target dcp1a
Chr9:60809502..60809525 20/24 Sense off-target hdac4
Chr8:89478736..89478759 22/24 Sense unknown
Chr1:215068296..215068319 20/24 Sense unknown
Publications
First: Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor., Development 2004                      
Most recent: Mcrs1 interacts with Six1 to influence early craniofacial and otic development., Dev Biol 2020                    
View All Papers