Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250230

Morpholino Name: reep4 MO2
Synonyms: TEgg068f10, Xtnovel51
Target mRNA: reep4

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAGAGATGATCCAGGATACCATTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 22/25
genome
MO
5' GAATGGTATCCTGGATCATCTCTCG 3'
   |||||||||||||||||||||||||
3' CTTACCATAGGACCTAGTAGAGAGC 5'
5' GGATGGTGTCCTGGATCATCTCCCG 3'
   | ||||| |||||||||||||| ||
3' CTTACCATAGGACCTAGTAGAGAGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:137967746..137967770 22/25 Sense target reep4.L
Chr3L:55428696..55428720 21/25 Antisense off-target reep2.L
Chr6S:101965656..101965680 21/25 Sense off-target sdcbp.S
Chr3S:98968249..98968273 21/25 Sense off-target LOC121402202
tropicalis 10.0 Chr3:129585451..129585475 25/25 Sense target reep4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Loss of REEP4 causes paralysis of the Xenopus embryo., Int J Dev Biol 2009            
View All Papers