Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250227

Morpholino Name: rdd3 MO1
Synonyms: rdd3/4 MO
Target mRNA: rdd3

Morpholino Type: uncategorized morpholino
Sequence: 5' TAAACATGGTGCTCACTCTCAGCAT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:132343992..132344016 25/25 Sense off-target rdd4.L
Chr7L:132379500..132379524 23/25 Sense off-target LOC121395664
Chr7L:132379500..132379524 23/25 Sense off-target LOC121395665
Chr7L:132409279..132409303 23/25 Sense off-target LOC121395662
Chr1S:201825852..201825876 21/25 Antisense off-target gba2.S
Chr7S:18410200..18410224 21/25 Sense off-target cnnm2.S
Chr7L:2517212..2517236 21/25 Antisense off-target LOC108695697
Chr9_10S:40179521..40179545 22/25 Sense unknown
Chr9_10S:40304180..40304204 22/25 Sense unknown
Chr9_10S:40425285..40425309 22/25 Sense unknown
Chr1L:210506099..210506123 21/25 Antisense unknown
Chr1L:64385014..64385038 21/25 Sense unknown
Chr2L:77296636..77296660 21/25 Sense unknown
tropicalis 10.0 Chr6:131502115..131502139 22/25 Sense unknown
Publications
First: A role of D domain-related proteins in differentiation and migration of embryonic cells in Xenopus laevis., Mech Dev 2008                              
Most recent:
View All Papers