Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250223

Morpholino Name: rbpms2 MO1
Synonyms: 3-11br1, HE-MO, HERMES
Target mRNA: rbpms2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTACAAGCCAGACTCCTCGGTGGGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GCCCACCGAGGAGTCTGGCTTGTAC 3'
   |||||||||||||||||||||||||
3' CGGGTGGCTCCTCAGACCGAACATG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:100284658..100284682 25/25 Sense target rbpms2.L
Publications
First: A role for the RNA-binding protein, hermes, in the regulation of heart development., Dev Biol 2002      
Most recent: Hermes Regulates Axon Sorting in the Optic Tract by Post-Trancriptional Regulation of Neuropilin 1., J Neurosci 2016          
View All Papers