Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250210

Morpholino Name: rax MO2
Synonyms: Xrx1 antisense morpholino, rax/Rx1
Target mRNA: rax

Morpholino Type: uncategorized morpholino
Sequence: 5' TCAGGGAAGGGCTGTGCAGGTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25 25/25
genome
MO
5' ATGCACCTGCACAGTCCTTCCCTGA 3'
   |||||||||||||| ||||||||||
3' TACGTGGACGTGTCGGGAAGGGACT 5'
5' ATGCACCTGCACAGTCCTCCCCTGA 3'
   |||||||||||||| ||| ||||||
3' TACGTGGACGTGTCGGGAAGGGACT 5'
5' ATGCACCTGCACAGCCCTTCCCTGA 3'
   |||||||||||||||||||||||||
3' TACGTGGACGTGTCGGGAAGGGACT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:189364214..189364238 25/25 Antisense target rax.S
Chr1L:218897659..218897683 23/25 Antisense target rax.L
Chr2L:56394093..56394117 21/25 Sense unknown
tropicalis 10.0 Chr1:201402406..201402430 24/25 Antisense target rax
Publications
First: Role of Xrx1 in Xenopus eye and anterior brain development., Development 1999              
Most recent: Characterization of the Rx1-dependent transcriptome during early retinal development., Dev Dyn 2014                                      
View All Papers