Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250209

Morpholino Name: rax MO1
Synonyms: Xrx1 AMO
Target mRNA: rax

Morpholino Type: uncategorized morpholino
Sequence: 5' TCGGGAAGGGCTGTGCAGGTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 20/24 22/24
genome
MO
5' ATGCACCTGCACAGTCCTTCCCTG 3'
   |||||||||||||| |||||||  
3' TACGTGGACGTGTCGGGAAGGGCT 5'
5' ATGCACCTGCACAGTCCTCCCCTG 3'
   |||||||||||||| ||| |||  
3' TACGTGGACGTGTCGGGAAGGGCT 5'
5' ATGCACCTGCACAGCCCTTCCCTG 3'
   ||||||||||||||||||||||  
3' TACGTGGACGTGTCGGGAAGGGCT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:189364214..189364237 22/24 Antisense target rax.S
Chr1L:218897659..218897682 20/24 Antisense target rax.L
Chr1S:94591870..94591893 20/24 Antisense off-target pde4c.S
Chr2L:111987298..111987321 20/24 Sense off-target dmd.1.L
Chr7L:12385650..12385673 20/24 Sense unknown
Chr7L:24474975..24474998 20/24 Antisense unknown
tropicalis 10.0 Chr1:201402406..201402429 21/24 Antisense target rax
Chr6:103750994..103751017 20/24 Antisense off-target tubb6
Publications
First: Xrx1 controls proliferation and neurogenesis in Xenopus anterior neural plate., Development 2003                
Most recent: Nucleosome regulator Xhmgb3 is required for cell proliferation of the eye and brain as a downstream target of Xenopus rax/Rx1., Dev Biol 2006            
View All Papers