Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250208

Morpholino Name: rassf7 MO2
Synonyms: RASSF7 MO1
Target mRNA: rassf7

Morpholino Type: uncategorized morpholino
Sequence: 5' CATCCACCCACACCTTCAGCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genome
MO
5' ATGGAGCTGAAGGTGTGGGTGGATG 3'
   |||||||||||||||||||||||||
3' TACCTCGACTTCCACACCCACCTAC 5'
5' ATGGAGCTGAAGGTGTGGGTGGATG 3'
   |||||||||||||||||||||||||
3' TACCTCGACTTCCACACCCACCTAC 5'
5' ATGGAGCTGAAAGTGTGGGTGGATG 3'
   ||||||||||| |||||||||||||
3' TACCTCGACTTCCACACCCACCTAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:25703982..25704006 25/25 Antisense target rassf7.L
Chr4S:2612782..2612806 24/25 Sense target rassf7.S
Chr8S:12424894..12424918 21/25 Sense unknown
tropicalis 10.0 Chr4:34441527..34441551 25/25 Antisense target rassf7
Chr10:22506604..22506628 22/25 Antisense off-target rbfox3
Chr3:147577160..147577184 21/25 Sense off-target mink1
Chr3:42035422..42035446 21/25 Antisense off-target ergic1
Chr5:161362575..161362599 21/25 Antisense off-target mapre3
Chr6:41034060..41034084 21/25 Sense off-target osbpl3
Chr3:2341025..2341049 23/25 Sense unknown
Publications
First: RASSF7 is a member of a new family of RAS association domain-containing proteins and is required for completing mitosis., Mol Biol Cell 2008                  
Most recent:
View All Papers