Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250207

Morpholino Name: rassf7 MO1
Synonyms: RASSF7 MO2
Target mRNA: rassf7

Morpholino Type: uncategorized morpholino
Sequence: 5' ATTGAACACGAGGAATGAGGTCGGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 21/25
genome
MO
5' GCCGACCTCATTCCTCGTGTTCAAT 3'
   |||||||||||||||||||||||||
3' CGGCTGGAGTAAGGAGCACAAGTTA 5'
5' GCCGACCCAATTCCTCGTGTTCAGC 3'
   |||||||  ||||||||||||||  
3' CGGCTGGAGTAAGGAGCACAAGTTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:25703957..25703981 25/25 Antisense target rassf7.L
Chr4S:2612807..2612831 21/25 Sense target rassf7.S
tropicalis 10.0 Chr8:123171369..123171393 22/25 Sense off-target LOC100493820
Chr8:123171369..123171393 22/25 Sense off-target LOC116406589
Chr10:37061840..37061864 21/25 Antisense off-target sulf2
Publications
First: RASSF7 is a member of a new family of RAS association domain-containing proteins and is required for completing mitosis., Mol Biol Cell 2008                  
Most recent:
View All Papers