Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250206

Morpholino Name: rasip1 MO1
Synonyms: Rasip1-MO
Target mRNA: rasip1

Morpholino Type: uncategorized morpholino
Sequence: 5' TAATAAAAGCCCAACCAACCTGCCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' CGGCAGGTTGGTTGGGCTTTTATTA 3'
   |||||||||||||||||||||||||
3' GCCGTCCAACCAACCCGAAAATAAT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:113524386..113524410 21/25 Sense off-target LOC108696711
Chr7L:113672529..113672553 21/25 Sense unknown
tropicalis 10.0 Chr7:105705778..105705802 25/25 Sense target rasip1
Chr8:115897398..115897422 21/25 Antisense off-target mta1
Chr1:140742259..140742283 21/25 Sense unknown
Chr1:191427348..191427372 21/25 Antisense unknown
Publications
First: Rasip1 is required for endothelial cell motility, angiogenesis and vessel formation., Dev Biol 2009        
Most recent:
View All Papers