Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250205

Morpholino Name: rasgrp2 MO3
Synonyms: XRASGRP2
Target mRNA: rasgrp2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCATTGGCTATTCTGAAGATCCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genome
MO
5' TTGGATCTTCGGAATAGCCAATGAG 3'
    ||||||||| ||||||||||||||
3' GACCTAGAAGTCTTATCGGTTACTC 5'
5' CTGGATCTTCAGAATAGCCAATGAA 3'
   |||||||||||||||||||||||| 
3' GACCTAGAAGTCTTATCGGTTACTC 5'
5' CTGGATCTTCAGAATAGCCAATGAG 3'
   |||||||||||||||||||||||||
3' GACCTAGAAGTCTTATCGGTTACTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:289173..289197 25/25 Sense target rasgrp2.S
Chr4L:31874942..31874966 24/25 Antisense target rasgrp2.L
Chr5L:1410041..1410065 22/25 Antisense off-target LOC108716400
tropicalis 10.0 Chr4:40498668..40498692 23/25 Antisense target rasgrp2
Publications
First: XRASGRP2 expression during early development of Xenopus embryos., Biochem Biophys Res Commun 2008          
Most recent:
View All Papers