Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250204

Morpholino Name: rasgrp2 MO2
Synonyms: RASGRP2-A, XRASGRP2a splice inhibition MO
Target mRNA: rasgrp2

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGAACTTTAGAAGCCTTACCAAAG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' CTTTGGTAAGGCTTCTAAAGTTCTG 3'
   |||||||||||||||||||||||||
3' GAAACCATTCCGAAGATTTCAAGAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:289074..289098 25/25 Sense target rasgrp2.S
Chr5L:136236723..136236747 22/25 Sense off-target gigyf2.L
Chr5L:136236723..136236747 22/25 Sense off-target kcnj13.L
tropicalis 10.0 Chr6:80208076..80208100 21/25 Antisense unknown
Chr7:74910865..74910889 21/25 Antisense unknown
Publications
First: XRASGRP2 is essential for blood vessel formation during Xenopus development., Int J Dev Biol 2010              
Most recent:
View All Papers