Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250203

Morpholino Name: rasgrp2 MO1
Synonyms: RASGRP2-B, XRASGRP2b splice inhibition MO
Target mRNA: rasgrp2

Morpholino Type: uncategorized morpholino
Sequence: 5' AGAAATTTAGAACCCATACCGAAGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GCTTCGGTATGGGTTCTAAATTTCT 3'
   |||||||||||||||||||||||||
3' CGAAGCCATACCCAAGATTTAAAGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:31875040..31875064 25/25 Antisense target rasgrp2.L
Publications
First: XRASGRP2 is essential for blood vessel formation during Xenopus development., Int J Dev Biol 2010              
Most recent:
View All Papers