Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250202

Morpholino Name: rarg MO2
Synonyms: Rargamma2
Target mRNA: rarg

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCCATGCAGTCATACATTTTGGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 21/24 23/24
genome
MO
5' GCCAACATGTACGACTGCATGGAA 3'
    |||| ||||| ||||||||||||
3' GGGTTTTACATACTGACGTACCTT 5'
5' CCCAAAATGTACGACTGCATGGAA 3'
   ||||||||||| ||||||||||||
3' GGGTTTTACATACTGACGTACCTT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:138975510..138975533 23/24 Antisense target rarg.S
Chr2L:155472755..155472778 24/24 Antisense off-target LOC108708649
Chr2S:96079820..96079843 21/24 Sense off-target nf1.S
Chr9_10L:89796187..89796210 21/24 Antisense off-target bmpr2.L
Chr1S:154839275..154839298 20/24 Antisense off-target aifm3.S
Chr6S:53096234..53096257 20/24 Antisense off-target adcy1.S
Chr7L:86279005..86279028 20/24 Sense off-target dixdc1.L
Chr3L:112792718..112792741 20/24 Sense off-target tp53bp1.L
Chr4L:43794189..43794212 20/24 Antisense off-target LOC108713498
Chr6L:103259160..103259183 21/24 Antisense unknown
Chr1L:104436563..104436586 20/24 Sense unknown
Chr1L:121083960..121083983 20/24 Antisense unknown
Chr5S:73508732..73508755 20/24 Antisense unknown
Chr8L:81156145..81156168 20/24 Sense unknown
tropicalis 10.0 Chr2:147345420..147345443 21/24 Antisense target rarg
Chr3:118133192..118133215 22/24 Sense off-target adamts7
Chr7:60240440..60240463 21/24 Antisense off-target ftsj3
Chr2:128785707..128785730 20/24 Antisense off-target pcdh9
Chr1:182470804..182470827 20/24 Sense off-target LOC116406436
Chr1:183815491..183815514 21/24 Sense unknown
Chr3:88516699..88516722 20/24 Sense unknown
Chr9:55016231..55016254 20/24 Antisense unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent: RARβ2 is required for vertebrate somitogenesis., Development 2017                                                
View All Papers