Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250200

Morpholino Name: rara MO6
Synonyms: Raralpha (D2)
Target mRNA: rara

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGCCCGTTACTCACATTCTTTAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 22/25 25/25
genome
MO
5' TCTAAAGAATGTGAGTAACAGGCAG 3'
   ||||||||||||||||||| |||  
3' AGATTTCTTACACTCATTGCCCGCG 5'
5' TCTAAAGAATGTGAGTATTGGGTGC 3'
   |||||||||||||||||  ||| ||
3' AGATTTCTTACACTCATTGCCCGCG 5'
5' TCTAAAGAATGTGAGTAACGGGCGC 3'
   |||||||||||||||||||||||||
3' AGATTTCTTACACTCATTGCCCGCG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:1457595..1457619 25/25 Sense target rara.S
Chr9_10L:1659217..1659241 22/25 Sense target rara.L
Chr5S:129102282..129102306 21/25 Antisense unknown
tropicalis 10.0 Chr10:8747605..8747629 22/25 Sense target rara
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent:
View All Papers