Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250198

Morpholino Name: rara MO4
Synonyms: XRARa 2.1, XRARalpha 2.1
Target mRNA: rara

Morpholino Type: uncategorized morpholino
Sequence: 5' AACTGACCATAGAGTGGAACCGAGC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GCTCGGTTCCACTCTATGGTCAGTT 3'
   |||||||||||||||||||||||||
3' CGAGCCAAGGTGAGATACCAGTCAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:1464448..1464472 25/25 Sense target rara.S
Publications
First: Multiple points of interaction between retinoic acid and FGF signaling during embryonic axis formation., Development 2004                
Most recent:
View All Papers