Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250197

Morpholino Name: rara MO3
Synonyms: Raralpha (D1)
Target mRNA: rara

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGTAACACTTACCTTGCAACCTTC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GAAGGTTGCAAGGTAAGTGTTACCC 3'
   |||||||||||||||||||||||||
3' CTTCCAACGTTCCATTCACAATGGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:1458791..1458815 25/25 Sense target rara.S
tropicalis 10.0 Chr4:105727033..105727057 21/25 Sense off-target pkn2
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent:
View All Papers