Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250196

Morpholino Name: rara MO2
Synonyms: RAR_2.2 MO, Raralpha2.2:, XRAR 2.2, xRAR 2, xRARalpha2
Target mRNA: rara

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCAAAGGAAGGTGAGTGTGTGTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CACACACACTCACCTTCCTTTGGAT 3'
   |||||||||||||||||||||||||
3' GTGTGTGTGAGTGGAAGGAAACCTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:1666245..1666269 25/25 Sense target rara.L
Chr4S:110387341..110387365 21/25 Sense off-target oxtr.S
Chr8L:106502392..106502416 21/25 Sense off-target npas3.L
Chr3S:37038342..37038366 21/25 Antisense off-target map2k1.S
Chr1L:154230614..154230638 22/25 Antisense unknown
Chr8S:73260193..73260217 22/25 Antisense unknown
Chr1L:12668696..12668720 21/25 Antisense unknown
Chr1S:131441821..131441845 21/25 Antisense unknown
Chr7S:111563336..111563360 21/25 Sense unknown
tropicalis 10.0 Chr4:131374445..131374469 21/25 Sense off-target oxtr
Chr7:75095905..75095929 21/25 Sense off-target robo3
Chr1:142261338..142261362 22/25 Antisense unknown
Chr9:35503682..35503706 21/25 Sense unknown
Chr7:13328746..13328770 21/25 Sense unknown
Chr9:35504306..35504330 21/25 Sense unknown
Chr9:35506566..35506590 21/25 Sense unknown
Chr9:35507258..35507282 21/25 Sense unknown
Chr9:35509204..35509228 21/25 Sense unknown
Chr9:35510911..35510935 21/25 Sense unknown
Chr9:35511154..35511178 21/25 Sense unknown
Chr9:35511260..35511284 21/25 Sense unknown
Chr9:35511787..35511811 21/25 Sense unknown
Chr9:35512000..35512024 21/25 Sense unknown
Chr9:35512243..35512267 21/25 Sense unknown
Chr9:35512349..35512373 21/25 Sense unknown
Chr9:35512876..35512900 21/25 Sense unknown
Chr9:35512982..35513006 21/25 Sense unknown
Chr9:35513199..35513223 21/25 Sense unknown
Chr9:35515336..35515360 21/25 Sense unknown
Chr9:35516524..35516548 21/25 Sense unknown
Chr9:35517657..35517681 21/25 Sense unknown
Chr9:35518025..35518049 21/25 Sense unknown
Chr9:35518729..35518753 21/25 Sense unknown
Chr9:35519602..35519626 21/25 Sense unknown
Chr9:35520343..35520367 21/25 Sense unknown
Publications
First: Active repression of RAR signaling is required for head formation., Genes Dev 2001              
Most recent: RARγ is required for mesodermal gene expression prior to gastrulation in Xenopus., Development 2018                            
View All Papers