Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250195

Morpholino Name: rara MO1
Synonyms: Raralpha1, xRAR 1, xRARalpha1
Target mRNA: rara

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTCCAAACGCACTTCTACTCCCTC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GAGGGAGTAGAAGTGCGTTTGGAGC 3'
   |||||||||||||||||||||||||
3' CTCCCTCATCTTCACGCAAACCTCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:1475612..1475636 25/25 Sense target rara.S
Publications
First: Active repression of RAR signaling is required for head formation., Genes Dev 2001              
Most recent: Retinoic acid promotes stem cell differentiation and embryonic development by transcriptionally activating CFTR., Biochim Biophys Acta Mol Cell Res 2018  
View All Papers