Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250194

Morpholino Name: rapgef4 MO1
Synonyms: Rapgef4-MO
Target mRNA: rapgef4

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGGCGAAATCCCATTACCTCTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ACAGAGGTAATGGGATTTCGCCAAG 3'
   |||||||||||||||||||||||||
3' TGTCTCCATTACCCTAAAGCGGTTC 5'
5' ACAGAGGTAATGGGATTTCGCCAAG 3'
   |||||||||||||||||||||||||
3' TGTCTCCATTACCCTAAAGCGGTTC 5'
5' ACAGAGGTAATGGGATTTCGCCAAG 3'
   |||||||||||||||||||||||||
3' TGTCTCCATTACCCTAAAGCGGTTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:76682594..76682618 25/25 Antisense target rapgef4.L
Chr9_10S:67156703..67156727 25/25 Antisense target rapgef4.S
Chr4L:55234695..55234719 21/25 Sense off-target has3.L
Chr5L:155138772..155138796 21/25 Sense unknown
tropicalis 10.0 Chr9:67023461..67023485 25/25 Sense target rapgef4
Chr2:66688112..66688136 21/25 Sense off-target pik3c2b
Chr8:72793628..72793652 21/25 Sense unknown
Publications
First: Regulation of G-protein signaling via Gnas is required to regulate proximal tubular growth in the Xenopus pronephros., Dev Biol 2013                          
Most recent: Polycystin 1 loss of function is directly linked to an imbalance in G-protein signaling in the kidney., Development 2018                          
View All Papers