Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250193

Morpholino Name: rap2b MO1
Synonyms: XRap2B MO
Target mRNA: rap2b

Morpholino Type: uncategorized morpholino
Sequence: 5' CAACTACTTTGTATTCCCGCATGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GCCATGCGGGAATACAAAGTAGTTG 3'
   |||||||||||||||||||||||||
3' CGGTACGCCCTTATGTTTCATCAAC 5'
5' GCCATGCGGGAATACAAAGTAGTTG 3'
   |||||||||||||||||||||||||
3' CGGTACGCCCTTATGTTTCATCAAC 5'
5' GCCATGCGGGAATACAAAGTAGTTG 3'
   |||||||||||||||||||||||||
3' CGGTACGCCCTTATGTTTCATCAAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:125169811..125169835 25/25 Sense target rap2b.L
Chr5S:104824226..104824250 25/25 Sense target rap2b.S
Chr6S:55430932..55430956 21/25 Sense off-target galnt1.S
Chr3S:61673673..61673697 21/25 Antisense off-target LOC108713002
Chr1S:81100573..81100597 21/25 Sense unknown
Chr5L:60736205..60736229 21/25 Sense unknown
tropicalis 10.0 Chr5:117182688..117182712 25/25 Sense target rap2b
Publications
First: Rap2 is required for Wnt/beta-catenin signaling pathway in Xenopus early development., EMBO J 2005  
Most recent: Role of the Rap2/TNIK kinase pathway in regulation of LRP6 stability for Wnt signaling., Biochem Biophys Res Commun 2013          
View All Papers