Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250192

Morpholino Name: rap2a MO1
Synonyms: XRap2A MO
Target mRNA: rap2a

Morpholino Type: uncategorized morpholino
Sequence: 5' GACCACCACCTTATACTCGCGCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' GATGCGTGAGTATAAGGTGGTGGTC 3'
   |||||| ||||||||||||||||||
3' CTACGCGCTCATATTCCACCACCAG 5'
5' GATGCGCGAGTATAAGGTGGTGGTC 3'
   |||||||||||||||||||||||||
3' CTACGCGCTCATATTCCACCACCAG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:112298725..112298749 25/25 Sense target rap2a.S
Chr2L:126588139..126588163 25/25 Sense off-target LOC100505442
Chr2S:52625192..52625216 21/25 Sense off-target rap1a.S
tropicalis 10.0 Chr2:121614733..121614757 24/25 Sense target rap2a
Chr2:59474692..59474716 21/25 Antisense off-target rap1a
Publications
First: Rap2 is required for Wnt/beta-catenin signaling pathway in Xenopus early development., EMBO J 2005  
Most recent: Role of the Rap2/TNIK kinase pathway in regulation of LRP6 stability for Wnt signaling., Biochem Biophys Res Commun 2013          
View All Papers