Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250191

Morpholino Name: ran MO1
Synonyms: xRan1-MO
Target mRNA: ran

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTTTGTCAGCCTTCCAGAAGCGTC 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: IQGAP1 protein regulates nuclear localization of β-catenin via importin-β5 protein in Wnt signaling., J Biol Chem 2013  
Most recent:
View All Papers