Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250190

Morpholino Name: racgap1 MO3
Synonyms: MgcRacGAP UTR1
Target mRNA: racgap1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCACTCTCAGTGACACGCAGCCG 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 23/24
genome
MO
5' CGGCTGCGTGTCACTAAGAGTGCC 3'
   ||||||||||||||| ||||||||
3' GCCGACGCACAGTGACTCTCACGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:140130657..140130680 23/24 Sense target racgap1.S
Chr2L:801044..801067 20/24 Antisense off-target timmdc1.L
Publications
First: Regulation of cytokinesis by Rho GTPase flux., Nat Cell Biol 2009        
Most recent:
View All Papers