Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250189

Morpholino Name: racgap1 MO2
Synonyms: MgcRacGAP
Target mRNA: racgap1

Morpholino Type: uncategorized morpholino
Sequence: 5' TAGGTTCATCAGGTTTGTCGCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GATGGCGACAAACCTGATGAACCTA 3'
   |||||||||||||||||||||||||
3' CTACCGCTGTTTGGACTACTTGGAT 5'
5' GATGGCGACAAACCTGATGAACCTA 3'
   |||||||||||||||||||||||||
3' CTACCGCTGTTTGGACTACTTGGAT 5'
5' GATGGCGACAAACCTGATGAACCTA 3'
   |||||||||||||||||||||||||
3' CTACCGCTGTTTGGACTACTTGGAT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:156839669..156839693 25/25 Sense target racgap1.L
Chr2S:140125490..140125514 25/25 Sense target racgap1.S
Chr2L:49804937..49804961 21/25 Sense off-target rap1gap2.L
tropicalis 10.0 Chr2:148523880..148523904 25/25 Sense target racgap1
Publications
First: Regulation of cytokinesis by Rho GTPase flux., Nat Cell Biol 2009        
Most recent: MgcRacGAP restricts active RhoA at the cytokinetic furrow and both RhoA and Rac1 at cell-cell junctions in epithelial cells., Mol Biol Cell 2015                  
View All Papers