Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250188

Morpholino Name: racgap1 MO1
Synonyms: MgcRacGAP UTR2
Target mRNA: racgap1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCTAATGGCACGGGAAGCCGGAAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 24/25
genome
MO
5' GATCCGGCTTCCCGTGCCATTAGAA 3'
   | |||||||||||||||||||||||
3' CAAGGCCGAAGGGCACGGTAATCTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:156847877..156847901 24/25 Sense target racgap1.L
tropicalis 10.0 Chr3:132904585..132904609 21/25 Sense off-target wiz
Chr9:25202844..25202868 21/25 Sense off-target otoa
Publications
First: Regulation of cytokinesis by Rho GTPase flux., Nat Cell Biol 2009        
Most recent:
View All Papers