Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250186

Morpholino Name: rab8b MO2
Synonyms: rab8b Mo1
Target mRNA: rab8b

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTAGTCGTAAGTCTTCGCCATCTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genome
MO
5' AAGATGGCGAAGACTTACGACTACC 3'
   |||||||||||||||||||||||||
3' TTCTACCGCTTCTGAATGCTGATGG 5'
5' AAGATGGCGAAGACTTATGACTACC 3'
   ||||||||||||||||| |||||||
3' TTCTACCGCTTCTGAATGCTGATGG 5'
5' AAGATGGCGAAGACTTACGACTACC 3'
   |||||||||||||||||||||||||
3' TTCTACCGCTTCTGAATGCTGATGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:61425161..61425185 25/25 Antisense target rab8b.S
Chr3L:97138107..97138131 24/25 Sense target rab8b.L
Chr1L:113961788..113961812 21/25 Antisense off-target rab8a.L
Chr1S:95226998..95227022 21/25 Antisense off-target rab8a.S
tropicalis 10.0 Chr3:91498324..91498348 25/25 Sense target rab8b
Chr1:104419063..104419087 21/25 Antisense off-target rab8a
Chr9:44505521..44505545 21/25 Sense off-target tmeff2
Chr6:67471969..67471993 21/25 Antisense unknown
Chr6:69075350..69075374 21/25 Antisense unknown
Publications
First: RAB8B is required for activity and caveolar endocytosis of LRP6., Cell Rep 2013                      
Most recent:
View All Papers