Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250185

Morpholino Name: rab8b MO1
Synonyms: rab8b MO2
Target mRNA: rab8b

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGTCTTCGCCATCTTTAGTCCTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genome
MO
5' GGAGGACTAAAGATGGCGAAGACTT 3'
   |||||||||||||||||||||||||
3' CCTCCTGATTTCTACCGCTTCTGAA 5'
5' GGACGACTAAAGATGGCGAAGACTT 3'
   ||| |||||||||||||||||||||
3' CCTCCTGATTTCTACCGCTTCTGAA 5'
5' GGAGGACTAAAGATGGCGAAGACTT 3'
   |||||||||||||||||||||||||
3' CCTCCTGATTTCTACCGCTTCTGAA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:61425152..61425176 25/25 Antisense target rab8b.S
Chr3L:97138116..97138140 24/25 Sense target rab8b.L
Chr2L:59086998..59087022 21/25 Antisense off-target ppp1r8.L
tropicalis 10.0 Chr3:91498333..91498357 25/25 Sense target rab8b
Chr2:79521718..79521742 21/25 Sense off-target ppp1r8
Publications
First: RAB8B is required for activity and caveolar endocytosis of LRP6., Cell Rep 2013                      
Most recent:
View All Papers