Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250182

Morpholino Name: rab11a MO1
Synonyms: Rab11-MO
Target mRNA: rab11a

Morpholino Type: uncategorized morpholino
Sequence: 5' TACCCATCGTCGCGGCACTTCTGAC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' GACAGAAGTGCCGCGAGGATGGGTA 3'
   | |||||||||||||| ||||||||
3' CAGTCTTCACGGCGCTGCTACCCAT 5'
5' GTCAGAAGTGCCGCGACGATGGGTA 3'
   |||||||||||||||||||||||||
3' CAGTCTTCACGGCGCTGCTACCCAT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:37383478..37383502 25/25 Sense target rab11a.S
Chr3L:123327692..123327716 23/25 Antisense target rab11a.L
Publications
First: Rab11 regulates planar polarity and migratory behavior of multiciliated cells in Xenopus embryonic epidermis., Dev Dyn 2012              
Most recent: Vangl2 cooperates with Rab11 and Myosin V to regulate apical constriction during vertebrate gastrulation., Development 2015                          
View All Papers