Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250101

Morpholino Name: pitx3 MO1
Synonyms: P3MO, pitx3
Target mRNA: pitx3

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGGCTAATCCTGGTTGAAGGGAAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' ATTCCCTTCGGCCAGGATTAGCCCA 3'
   |||||||||  ||||||||||||||
3' TAAGGGAAGTTGGTCCTAATCGGGT 5'
5' ATTCCCTTCAACCAGGATTAGCCCA 3'
   |||||||||||||||||||||||||
3' TAAGGGAAGTTGGTCCTAATCGGGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:41635153..41635177 25/25 Sense target pitx3.L
Chr3L:77649645..77649669 21/25 Sense off-target grm8.L
Chr7S:32869880..32869904 23/25 Sense unknown
Chr1L:58611048..58611072 21/25 Antisense unknown
tropicalis 10.0 Chr7:43880378..43880402 23/25 Sense target pitx3
Publications
First: Lens and retina formation require expression of Pitx3 in Xenopus pre-lens ectoderm., Dev Dyn 2005          
Most recent: Xenopus pitx3 target genes lhx1 and xnr5 are identified using a novel three-fluor flow cytometry-based analysis of promoter activation and repression., Dev Dyn 2017                      
View All Papers