Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250090

Morpholino Name: pdzk1ip1 MO1
Synonyms: XPteg MO
Target mRNA: pdzk1ip1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGGGAGAACATAGTTGCAAAGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 23/25 25/25
genome
MO
5' CTATCGGCAACTATGTTATCCCTGC 3'
   || |  ||||||||||| |||||||
3' GAGAAACGTTGATACAAGAGGGACG 5'
5' CTCTCGGCAACTATGTTCTCCCTGC 3'
   ||||  |||||||||||||||||||
3' GAGAAACGTTGATACAAGAGGGACG 5'
5' CTCTTTGCAACTATGTTCTCCCTGC 3'
   |||||||||||||||||||||||||
3' GAGAAACGTTGATACAAGAGGGACG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:73870975..73870999 25/25 Sense target pdzk1ip1.S
Chr4L:88977323..88977347 23/25 Sense target pdzk1ip1.L
Chr9_10L:55005632..55005656 21/25 Sense off-target scpep1.L
Chr5S:122333027..122333051 21/25 Sense off-target LOC108718228
Chr6S:84611994..84612018 21/25 Antisense unknown
Chr3L:134031249..134031273 21/25 Sense unknown
tropicalis 10.0 Chr4:93922380..93922404 21/25 Sense target pdzk1ip1
Chr1:159134037..159134061 21/25 Sense off-target tmem132c
Publications
First: XPteg (Xenopus proximal tubules-expressed gene) is essential for pronephric mesoderm specification and tubulogenesis., Mech Dev 2010                    
Most recent:
View All Papers