Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250086

Morpholino Name: pcsk7 MO2
Synonyms: XSPC7 Antisense Morpholino #2
Target mRNA: pcsk7

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCAGTCCAGCAAGTTCATCAGGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genome
MO
5' GTCCTAATGCACTTGCTGGACTGCC 3'
   ||||| ||| |||||||||||||||
3' CAGGACTACTTGAACGACCTGACGG 5'
5' GTCCTGATGAACTTGCTGGACTGCC 3'
   |||||||||||||||||||||||||
3' CAGGACTACTTGAACGACCTGACGG 5'
5' GACCTGATGAACTTGCTGGACTGCC 3'
   | |||||||||||||||||||||||
3' CAGGACTACTTGAACGACCTGACGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:83572338..83572362 25/25 Antisense target pcsk7.L
Chr7S:71430052..71430076 24/25 Antisense target pcsk7.S
Chr4L:85315065..85315089 21/25 Sense unknown
Chr5L:124317098..124317122 21/25 Sense unknown
tropicalis 10.0 Chr7:81981126..81981150 23/25 Antisense target pcsk7
Publications
First: A homolog of Subtilisin-like Proprotein Convertase 7 is essential to anterior neural development in Xenopus., PLoS One 2012                  
Most recent:
View All Papers