Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250064

Morpholino Name: pax2 MO2
Synonyms: pax2-specific morpholino2
Target mRNA: pax2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGTCTGCCTTGCAGTGCATATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' ATGGATATGCACTGCAAGGCAGATC 3'
   ||||||||||||||||||||||| |
3' TACCTATACGTGACGTTCCGTCTGG 5'
5' ATGGATATGCACTGCAAGGCAGACC 3'
   |||||||||||||||||||||||||
3' TACCTATACGTGACGTTCCGTCTGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:40853867..40853891 25/25 Antisense target pax2.L
Chr7S:32158668..32158692 24/25 Antisense off-target LOC108697493
Chr9_10S:3135918..3135942 22/25 Sense off-target LOC108702522
Chr5S:64848634..64848658 21/25 Antisense off-target foxo3.S
Chr1S:96439702..96439726 21/25 Antisense unknown
tropicalis 10.0 Chr7:43096838..43096862 24/25 Antisense target pax2
Chr9:32621174..32621198 21/25 Antisense unknown
Publications
First: En2, Pax2/5 and Tcf-4 transcription factors cooperate in patterning the Xenopus brain., Dev Biol 2010                    
Most recent: Hnf1b renal expression directed by a distal enhancer responsive to Pax8., Sci Rep 2022              
View All Papers