Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17250049

Morpholino Name: p2rx1 MO1
Synonyms: Xint-MO
Target mRNA: p2rx1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATATTCCCCTTACCTATTAGACCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 21/24
genome
MO
5' AGATCTAATAGGTAAGGGGAAAAA 3'
   || |||||||||||||||||| | 
3' TCCAGATTATCCATTCCCCTTATA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:52964450..52964473 22/24 Sense off-target intu.S
Chr1S:89226813..89226836 20/24 Antisense off-target ap1m1.S
Chr4S:125323416..125323439 20/24 Sense off-target ptprg.S
Chr9_10S:24663443..24663466 20/24 Antisense off-target aspscr1.S
tropicalis 10.0 Chr2:101656729..101656752 21/24 Antisense target p2rx1
Chr6:26945840..26945863 20/24 Sense off-target trnan-guu
Publications
First: Ciliogenesis defects in embryos lacking inturned or fuzzy function are associated with failure of planar cell polarity and Hedgehog signaling., Nat Genet 2006  
Most recent: Dishevelled controls apical docking and planar polarization of basal bodies in ciliated epithelial cells., Nat Genet 2008        
View All Papers