Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249995

Morpholino Name: nkx6-1 MO1
Synonyms: nkx6.1MO1
Target mRNA: nkx6-1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCATCTGCCCTAAGGTTAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/24 24/24
genome
MO
5' ATGTTAACCTTAGGGCAGATGGAA 3'
   ||||||||||||||||||||||| 
3' TACAATTGGAATCCCGTCTACCTA 5'
5' ATGTTAACCTTAGGGCAGATGGAT 3'
   ||||||||||||||||||||||||
3' TACAATTGGAATCCCGTCTACCTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:92791972..92791995 24/24 Antisense target nkx6-1.L
Chr1S:76690924..76690947 23/24 Sense off-target LOC108704117
Chr1L:25618292..25618315 20/24 Sense off-target sorcs2.L
Chr4L:79313156..79313179 20/24 Sense off-target cachd1.L
tropicalis 10.0 Chr1:86250891..86250914 23/24 Sense target nkx6-1
Chr6:114220571..114220594 21/24 Sense unknown
Chr6:68620474..68620497 20/24 Sense unknown
Publications
First: Nkx6 genes pattern the frog neural plate and Nkx6.1 is necessary for motoneuron axon projection., Dev Biol 2011                              
Most recent:
View All Papers