Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249993

Morpholino Name: nkx2-5 MO1
Synonyms: nkx2.5 MO
Target mRNA: nkx2-5

Morpholino Type: uncategorized morpholino
Sequence: 5' GGATGTCACAGGACTGGCAAACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 23/25 25/25
genome
MO
5' CATGTTTGCCAGCCCTGTGACTTCC 3'
   |||||||||||| |||||||| |||
3' GTACAAACGGTCAGGACACTGTAGG 5'
5' CATGTTTGCCAGCCCTGTGACTTCC 3'
   |||||||||||| |||||||| |||
3' GTACAAACGGTCAGGACACTGTAGG 5'
5' CATGTTTGCCAGTCCTGTGACATCC 3'
   |||||||||||||||||||||||||
3' GTACAAACGGTCAGGACACTGTAGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:103546330..103546354 25/25 Sense target nkx2-5.S
Chr3L:50953888..50953912 23/25 Antisense target nkx2-5.L
Chr3L:50960353..50960377 23/25 Antisense target nkx2-5.L
Chr3S:128704776..128704800 22/25 Sense off-target LOC108703541
tropicalis 10.0 Chr3:43398346..43398370 23/25 Antisense target nkx2-5
Chr3:126540349..126540373 21/25 Sense off-target gck
Publications
First: HIF-1alpha signaling upstream of NKX2.5 is required for cardiac development in Xenopus., J Biol Chem 2008                          
Most recent: Nkx2.5 is involved in myeloid cell differentiation at anterior ventral blood islands in the Xenopus embryo., Dev Growth Differ 2014                
View All Papers