Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249938

Morpholino Name: myh6 MO1
Synonyms: myh6
Target mRNA: myh6

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTCTGCCATCAGGGCATCACCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 24/25
genome
MO
5' ATGGGTGATGCCCTGATGGCAGACT 3'
   |||||||||||||||||||||||||
3' TACCCACTACGGGACTACCGTCTGA 5'
5' ATGGGTGATGCCGCGATGGCAGACT 3'
   ||||||||||||  |||||||||||
3' TACCCACTACGGGACTACCGTCTGA 5'
5' ATGGGTGATGCCATGATGGCAGACT 3'
   |||||||||||| ||||||||||||
3' TACCCACTACGGGACTACCGTCTGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:129989632..129989656 24/25 Sense target myh6.S
Chr1L:150942877..150942901 23/25 Sense target myh6.L
Chr4L:26731952..26731976 22/25 Sense off-target macrod1.L
Chr3L:33370731..33370755 21/25 Antisense off-target LOC108710881
Chr5S:141125431..141125455 21/25 Antisense off-target LOC108717514
Chr2S:150916293..150916317 21/25 Sense unknown
Chr6S:133888262..133888286 21/25 Sense unknown
Chr5S:141147000..141147024 21/25 Antisense unknown
tropicalis 10.0 Chr1:139793765..139793789 25/25 Sense target myh6
Chr5:22885413..22885437 21/25 Sense off-target nrxn1
Chr5:47616508..47616532 21/25 Sense off-target crim1
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent: Quantitative Phenotyping of Xenopus Embryonic Heart Pathophysiology Using Hemoglobin Contrast Subtraction Angiography to Screen Human Cardiomyopathies., Front Physiol 2019        
View All Papers