Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249934

Morpholino Name: myf5 MO1
Synonyms: XMyf5
Target mRNA: myf5

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCATCTCCATTCTGAATAGTGCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' CAGCAGTATTCAGAATGGAGATGGT 3'
   ||||| |||||||||||||||||||
3' GTCGTGATAAGTCTTACCTCTACCA 5'
5' CAGCACTATTCAGAATGGAGATGGT 3'
   |||||||||||||||||||||||||
3' GTCGTGATAAGTCTTACCTCTACCA 5'
5' CAGCACTAGTCAGAATGGAGATGGT 3'
   |||||||| ||||||||||||||||
3' GTCGTGATAAGTCTTACCTCTACCA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:59688195..59688219 25/25 Antisense target myf5.L
Chr3S:94845267..94845291 24/25 Sense target myf5.S
Chr1L:174441573..174441597 22/25 Sense unknown
Chr5L:128753598..128753622 22/25 Antisense unknown
Chr5S:88927737..88927761 21/25 Antisense unknown
Chr6L:52102633..52102657 21/25 Sense unknown
Chr7L:25749983..25750007 21/25 Antisense unknown
tropicalis 10.0 Chr3:52544008..52544032 24/25 Antisense target myf5
Chr1:107410048..107410072 22/25 Antisense off-target tstd2
Chr1:87642774..87642798 21/25 Antisense unknown
Publications
First: FGF8, Wnt8 and Myf5 are target genes of Tbx6 during anteroposterior specification in Xenopus embryo., Dev Biol 2006                      
Most recent: dmrt2 and myf5 Link Early Somitogenesis to Left-Right Axis Determination in Xenopus laevis., Front Cell Dev Biol 2022                    
View All Papers