Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249904

Morpholino Name: mix1 MO2
Synonyms: mix.2
Target mRNA: mix1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGATCAGGAATCCTACTTACCTAAG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:22785874..22785898 21/25 Antisense unknown
Publications
First: Mix.1/2-dependent control of FGF availability during gastrulation is essential for pronephros development in Xenopus., Dev Biol 2008                    
Most recent:
View All Papers