Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249895

Morpholino Name: meis3 MO1
Synonyms: Meis3-MO, XMeis3, XMeis3 AMO
Target mRNA: meis3

Morpholino Type: uncategorized morpholino
Sequence: 5' ATACCTTTGTGCCATTCCGAGTTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 22/25 21/25
genome
MO
5' CCGACTCGGAATGGCACAAAGGGTA 3'
   || |||||||||||||||||||   
3' GGTTGAGCCTTACCGTGTTTCCATA 5'
5' CCAACTCGGAATGGCACAAAGGGTA 3'
   ||||||||||||||||||||||   
3' GGTTGAGCCTTACCGTGTTTCCATA 5'
5' CCGACTCGGAATGGCACAAAGGGTA 3'
   || |||||||||||||||||||   
3' GGTTGAGCCTTACCGTGTTTCCATA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:71374234..71374258 22/25 Antisense target meis3.L
Chr8S:85747842..85747866 21/25 Antisense target meis3.S
Chr2S:117533885..117533909 21/25 Sense off-target lmo7.S
tropicalis 10.0 Chr8:80080827..80080851 21/25 Antisense target meis3
Publications
First: A Meis family protein caudalizes neural cell fates in Xenopus., Mech Dev 1999            
Most recent: A novel function for Egr4 in posterior hindbrain development., Sci Rep 2015                                
View All Papers