Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249890

Morpholino Name: med15 MO1
Synonyms: XARC105 MO
Target mRNA: med15

Morpholino Type: uncategorized morpholino
Sequence: 5' CAACACCTGCTTTCCTCATTGCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' GAAGCTATGAGGAAAGCTGGTGTTG 3'
   ||||| ||||||||||| |||||||
3' CTTCGTTACTCCTTTCGTCCACAAC 5'
5' GAAGCAATGAGGAAAGCAGGTGTTG 3'
   |||||||||||||||||||||||||
3' CTTCGTTACTCCTTTCGTCCACAAC 5'
5' GAAGCAATGAGGAAAGCAGGTGTTG 3'
   |||||||||||||||||||||||||
3' CTTCGTTACTCCTTTCGTCCACAAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:165600456..165600480 25/25 Sense target med15.L
Chr1S:141913373..141913397 25/25 Sense target med15.S
Chr6L:132147985..132148009 22/25 Sense off-target LOC108719304
Chr4L:85283566..85283590 21/25 Sense off-target akr1a1.L
Chr4S:129958832..129958856 21/25 Sense off-target cacna2d3.S
tropicalis 10.0 Chr1:152795725..152795749 23/25 Sense target med15
Chr5:161226655..161226679 22/25 Antisense off-target dnmt3a
Chr5:161226655..161226679 22/25 Antisense off-target LOC108645175
Chr8:84938590..84938614 21/25 Antisense unknown
Publications
First: A component of the ARC/Mediator complex required for TGF beta/Nodal signalling., Nature 2002  
Most recent:
View All Papers