Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249856

Morpholino Name: ras-dva1 MO1
Synonyms: Ras-dva
Target mRNA: ras-dva1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTGAGATTGCGCTTTCTTTTGTCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CAGACAAAAGAAAGCGCAATCTCAC 3'
   |||||||||||||||||||||||||
3' GTCTGTTTTCTTTCGCGTTAGAGTG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:115875314..115875338 25/25 Antisense target ras-dva1.L
Chr7S:28581257..28581281 21/25 Sense off-target pik3ap1.S
Chr2L:78195693..78195717 21/25 Antisense unknown
Chr6L:96581597..96581621 21/25 Antisense unknown
Publications
First: Ras-dva, a member of novel family of small GTPases, is required for the anterior ectoderm patterning in the Xenopus laevis embryo., Development 2006    
Most recent: Ras-dva small GTPases lost during evolution of amniotes regulate regeneration in anamniotes., Sci Rep 2018                                                      
View All Papers